摘要 :
E3 ubiquitin ligases determine which intracellular proteins are targets of the ubiquitin conjugation pathway and thus play a key role in determining the half-life, subcellular localization and/or activation status of their target ...
展开
E3 ubiquitin ligases determine which intracellular proteins are targets of the ubiquitin conjugation pathway and thus play a key role in determining the half-life, subcellular localization and/or activation status of their target proteins. Itchy mice lack the E3 ligase, Itch, and show dysregulation of T lymphocytes and the induction of a lethal autoimmune inflammatory condition. Itch is widely expressed in hematopoietic and nonhematopoietic cells, and we demonstrate that disease is transferred exclusively by hematopoietic cells. Moreover, distinct manifestations of the autoimmune inflammatory phenotype are contributed by discrete populations of lymphocytes. The presence of Itch-deficient alphabeta T cells drives expansion of peritoneal B1b cells and elevated IgM levels, which correlate with itching and pathology. In contrast, Itch(-/-) interleukin-4-producing gammadelta T cells, even in the absence of alphabeta T cells, are associated with elevated levels of IgE and an inflammatory condition. These data indicate that disruption of an E3 ubiquitin ligase in alphabeta T cells can subvert a B-cell subpopulation, which normally functions to control particular microbial pathogens in a T-independent manner, to contribute to autoimmunity. In addition, disruption of Itch in innate gammadelta T cells can influence autoimmune pathology and might therefore require distinct therapeutic intervention.
收起
摘要 :
The outcome of classical Hodgkin lymphoma (cHL) patients may be related to the tumor microenvironment, which in turn may be influenced by Epstein-Barr virus (EBV) infection. To characterize the cHL microenvironment, a set of 63 cH...
展开
The outcome of classical Hodgkin lymphoma (cHL) patients may be related to the tumor microenvironment, which in turn may be influenced by Epstein-Barr virus (EBV) infection. To characterize the cHL microenvironment, a set of 63 cHL tissue samples was profiled using DNA microarrays. Their gene expression profile differed from that of histiocyte T cell-rich B-cell lymphoma (H/TCRBCL) samples that were used as controls, mainly due to high expression of PDCD1/PD-1 in H/TCRBCL. EBV(+) cHL tissues could be distinguished from EBV(-) samples by a gene signature characteristic of Th1 and antiviral responses. Samples from cHL patients with favorable outcome overexpressed genes specific for B cells and genes involved in apoptotic pathways. An independent set of 146 cHL samples was analyzed using immunohistochemistry. It showed a significant adverse value in case of high percentage of either TIA-1(+)-reactive cells or topoisomerase-2(+) tumor cells, whereas high numbers of BCL11A(+), FOXP3(+), or CD20(+) reactive cells had a favorable influence. Our results suggest an antitumoral role for B cells in the cHL microenvironment and a stronger stromal influence of the PD1 pathway in H/TCRBCL than cHL. The observation of Th1/ antiviral response in EBV(+) cHL tissues provides a basis for novel treatment strategies.
收起
摘要 :
Crosspresentation is the phenomenon by which antigens are processed by antigen-presenting cells and presented to CD8~+ T lymphocytes on MHC/HLA class I molecules. Crosspresentation is primarily performed by dendritic cells (DCs) a...
展开
Crosspresentation is the phenomenon by which antigens are processed by antigen-presenting cells and presented to CD8~+ T lymphocytes on MHC/HLA class I molecules. Crosspresentation is primarily performed by dendritic cells (DCs) and is likely to be an essential mechanism for the initiation of cytotoxic T-cell responses as well as for tolerance maintenance. Initially reported by Michael J. Bevan back in 1975, crosspresentation has remained a mystery in terms of the mechanisms allowing this form of antigen processing to occur. But in recent years, some insights have shed light on this pathway
收起
摘要 :
Leukemic relapses remain the major cause of treatment failure in childhood acute lymphoblastic leukemias (ALL). Resistance to chemothera- py may be intrinsic to lymphoblasts, but it is also possible that the environment may minimi...
展开
Leukemic relapses remain the major cause of treatment failure in childhood acute lymphoblastic leukemias (ALL). Resistance to chemothera- py may be intrinsic to lymphoblasts, but it is also possible that the environment may minimize the effects of antileukemic drugs. Leukemic blasts may infiltrate areas where the levels of chemotherapies are suboptimal. In addition, the envi- ronment may provide prosurvival signals to the leukemic cells. There is scant information on the molecular basis of these processes. Identifying molecules that allow the leukemic cells to localise and survive in special niches may help in finding new targets for those patients at high risk for relapses. Aims. To assess whether chemokines expressed by ALL blasts may have a role in relaps- es. Methods. We compared the levels of chemokine receptors in marrow sam- ples from 94 children with ALL, under an approved protocol. Clinical data were collected from each patient for statistical analysis. Eighty-two samples were drawn at the time of diagnosis, and 15 at relapse. Only 3 patients had samples corresponding to diagnosis and to relapse. We quantitated the levels of chemokines in central system fluid (CSF) samples by ELISA or by Bioplex assays. The functional role of specific chemokines was studied in vitro and in vivo. Chemotaxis was assessed in standard transwell assays.
收起
摘要 :
According to the risk-stratifications of the karyotypes of adult AML, intermediate-risk group is mostly comprised of cytogenetically-normal (CN)-AML and other undefined karyotypes. According to the European Leukemia Net (ELN) guid...
展开
According to the risk-stratifications of the karyotypes of adult AML, intermediate-risk group is mostly comprised of cytogenetically-normal (CN)-AML and other undefined karyotypes. According to the European Leukemia Net (ELN) guidelines, CN-AML is divided into four molecular sub- groups based on the mutation statuses of NPM1 and FLT3-ITD. Except isolat- ed NPM1mut CN-AML, another 3 subgroups belong to the risk-group of ‘Inter- mediate-I’, but the guidelines suggest that most of the cases in the ‘Intermedi- ate-1’ risk-group are associated with poor prognosis.
收起
摘要 :
Background. T-cell acute lymphoblastic leukemia (T-ALL) is a malig- nancy of T-cell precursors that mainly occurs in children and adoles- cents. Optimization of chemotherapy regimens has resulted in im- proved responses with cure ...
展开
Background. T-cell acute lymphoblastic leukemia (T-ALL) is a malig- nancy of T-cell precursors that mainly occurs in children and adoles- cents. Optimization of chemotherapy regimens has resulted in im- proved responses with cure rates up to 75% in children. However, the current therapies are very toxic and cure rates rapidly decline in older patients, indicating the need for better and less toxic therapies. Aims. To discover new mutations that are implicated in the pathogenesis of T- ALL, we sequenced the coding regions of 97 genes in T-ALL cell lines and T-ALL samples. Methods. We captured all exons of 97 genes (known and candidate oncogenes/tumor suppressor genes) and subse- quently sequenced these exons using 454 sequencing technology. In ad- dition, all exons of the TYK2 gene were sequenced according to the Sanger method in diagnostic samples of 96 T-ALL patients; 54 acute myeloid leukemia (AML) and 53 B-ALL patients. Identified point mu- tations were cloned and introduced into Ba/F3 (IL3 dependent B-cells) and MOHITO (IL7 dependent T-cells) cells for assessment of trans- forming capacity, autophosphorylation and activation of downstream signaling pathways.
收起
摘要 :
de of the nuclear pore complex (NPC), plays a critical role in cell cycle progression and import/export trafficking. In T-cell acute lymphoblas- tic leukemia (T-ALL) NUP214 fusions appear to predict a poor progno- sis. So far two ...
展开
de of the nuclear pore complex (NPC), plays a critical role in cell cycle progression and import/export trafficking. In T-cell acute lymphoblas- tic leukemia (T-ALL) NUP214 fusions appear to predict a poor progno- sis. So far two NUP214 fusions were identified in T-ALL: when cryptic del(9q) is present SET fuses with NUP214, while episomal amplification leads NUP214 to rearrange with ABL1. Supervised gene expression pro- filing (GEP) analysis in adult T-ALL identified SET-NUP214 positive cases with high expression of HOXA cluster genes, MEIS1 and NUP214, and low expression of SET, FNBP1. C9orf78 and USP20 genes. 1 Among 69 cases of T-ALL, an additional case emerged at GEP analysis with over-expression of HOXA, MEIS1, NUP214, and also of SET. This 20- year old man with a chemo-resistant pre-T ALL showed 46,XY, del(6p) karyotype at diagnosis. Aims. To investigate last case as an hypotheti- cal new rearrangement involving NUP214 in T-ALL. Methods. We set up FISH assays with RP1-112N13 for the 9q sub-telomere, RP11-143H20, flanking the3’NUP214, RP11-544A12, spanning the gene, and two over- lapping fosmids, G248P89801E11 (exons 25-31) and G248P8659A12 (exons 31-36). Additional FISH experiments were done with 5q35-qter probes: RP11-117L6, RP11-286C20, RP11-549A4, RP11-319K2, RP11- 718N2, RP1-240G13. NESTED RT-PCR was performed using primers SQSTM1_ex3_528F (5’-TGCCCAGACTACGACTTGTG-3’) / NUP214_ex36_6543R (5’-AGTAATCATGCGCCTTGTGAGTT-3’), for the first amplification round, and SQSTM1_ex4/5_763F (5’- AATCAGCTTCTGGTCCATCG-3’)/NUP214_ex33/34_6337R (5’- CAAAGCTGAACCCTCCTGTG -3’) for the second. PCR products were cloned into pGEM-T easy vector system and sequenced. Results. FISH probe RP11-143H20 gave two signals on normal chromosomes 9 while RP11-544A12 and RP1-112N13 gave 3 signals on chromosomes 9 and on der(5). The NUP214 breakpoint fell between G248P89801E11, which was retained on chromosome 9, and G248P8659A12, translocat- ed to der(5).
收起
摘要 :
Up to now, as the first proteasome inhibitor to be approved for the treatment of both relapsed/refractory and newly diagnosed multiple myelo- ma (MM) patients, the bortezomib has emerged as an important therapeutic strategy in the...
展开
Up to now, as the first proteasome inhibitor to be approved for the treatment of both relapsed/refractory and newly diagnosed multiple myelo- ma (MM) patients, the bortezomib has emerged as an important therapeutic strategy in the treatment of MM. On account of the BiPN as an adverse effect, the dose and duration of bortezomib treatment were often limited. The incidence of BiPN reached as high as 37%. In addition, there was a lack of the effective evidence concerned with the treatments and prevention measures for BiPN. As an organic thiophosphate, amifostine, was used as a “detoxifying agent” dur- ing a cytotoxic treatment procedure. Besides, it was also thought to act as a ROS scavenger, which is an important component for cancer therapy. What’s more, it was demonstrated that amifostine could play a potential neuroprotec- tive role on preventing the cisplatin- and paclitaxel-induced neurotoxicityin. Aims: To examine whether amifostine could protect patients with multiple myeloma (MM) from bortezomib-induced peripheral neuropathy while main- taining the therapeutic efficacy.
收起
原文获取